-
Purpose(Empty Backbone)
-
Depositing Lab
-
Depositing OrganizationUniversity of Pennsylvania
Located in United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 43829 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepGP704
-
Backbone manufacturerJohn Mekalanos lab, Harvard Medical School (PMID: 2836362)
- Backbone size (bp) 5720
-
Modifications to backboneSacB1 from pUC58-sacB1 cloned into the EcoRI site. BamHI site in oriV converted to a ClaI site by partial digestion and Klenow treatment.
-
Vector typeBacterial Expression ; Bacterial allelic exchange vector with sacB1
-
Selectable markersSacB (sucrose sensitivity)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)SM10 λpir
-
Growth instructionsContains lambda pir-dependent R6K replication origin; requires lambda pir-containing bacteria strain
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer Amp-R (ATAATACCGCGCCACATAGC)
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySM10 λpir bacterial strain and pGP704 plasmid backbone from John Mekalanos, Harvard Medical School, Boston, MA. SacB1 gene from plasmid pUC58-sacBI from Dennis Ohman, VCU Medical Center, Richmond, VA.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmids deposited here comprise a set of SacB1-dependent allelic exchange vectors improved from a previously described suicide vector, pGP704 (Miller and Mekalanos, 1988), by including a system to select for plasmid loss by recombination.
Plasmid pRE107 was constructed by cloning the appropriate EcoRI fragment from pUC58-sacB1 (McIver et al., 1995) into pGP704 (see associated schematic image). The sacB1 allele is a modified variation of sacB, where unique restriction sites were removed by site directed mutagenesis (McIver et al., 1995). Additionally, the BamHI site in the R6K ori of the resulting plasmid was removed by partial BamHI digestion, blunting the resulting overhangs with PolIk (resulting in the formation of a ClaI site) and screening for its loss by restriction analysis.
The resulting plasmid together with others in this deposited series contain the conditional R6K ori, the origin of transfer (oriT) which allows conjugative transfer from permissive hosts, the sacB1 gene to provide negative selection and a MCS, along with a range of different AbR markers.
Note: Addgene's NGS results found that a large portion of the plasmid backbone (containing the oriT feature) is in the opposite orientation compared to the depositor's reference sequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRE107 was a gift from Dieter Schifferli (Addgene plasmid # 43829 ; http://n2t.net/addgene:43829 ; RRID:Addgene_43829) -
For your References section:
Improved allelic exchange vectors and their use to analyze 987P fimbria gene expression. Edwards RA, Keller LH, Schifferli DM. Gene. 1998 Jan 30;207(2):149-57. 10.1016/S0378-1119(97)00619-7 PubMed 9511756