-
Purpose(Empty Backbone)
-
Depositing Lab
-
Depositing OrganizationUniversity of Pennsylvania
Located in United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 43830 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepRE107 (modified from pGP704)
-
Backbone manufacturerAddgene plasmid 43829
- Backbone size (bp) 5173
-
Modifications to backboneFrom pGP704: SacB1 from pUC58-sacB1 cloned into the EcoRI site. BamHI site in oriV converted to a ClaI site by partial digestion and Klenow treatment. From pRE107: Ampicillin resistance replaced with Kanamycin resistance (from pUC71-K) by BamHI digestion.
-
Vector typeBacterial Expression ; Bacterial allelic exchange vector with sacB1
-
Selectable markersSacB (sucrose sensitivity)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)CC118 λpir
-
Growth instructionsContains lambda pir-dependent R6K replication origin; requires lambda pir-containing bacteria strain
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer KanR2-F (GAACTGCCTCGGTGAGTTTT)
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCC118 λpir bacterial strain from Jon Beckwith, Harvard Medical School, Boston, MA (provided by Dr. Ronald K. Taylor, now at Dartmouth Medical School, Hanover, NH). pGP704 plasmid backbone from John Mekalanos, Harvard Medical School, Boston, MA. SacB1 gene from plasmid pUC58-sacBI from Dennis Ohman, VCU Medical Center, Richmond, VA. KmR/aminoglycoside transferase gene (aphA) from pUC71-K from Joachim Messing, Waksman Institute Rutgers University Busch Campus, Piscataway, NJ.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmids deposited here comprise a set of SacB1-dependent allelic exchange vectors improved from a previously described suicide vector, pGP704 (Miller and Mekalanos, 1988), by including a system to select for plasmid loss by recombination.
Plasmid pRE107 (Addgene plasmid #43829) was constructed by cloning the appropriate EcoRI fragment from pUC58-sacB1 (McIver et al., 1995) into pGP704 (see associated schematic image). The sacB1 allele is a modified variation of sacB, where unique restriction sites were removed by site directed mutagenesis (McIver et al., 1995). Additionally, the BamHI site in the R6K ori of the resulting plasmid was removed by partial BamHI digestion, blunting the resulting overhangs with PolIk (resulting in the formation of a ClaI site) and screening for its loss by restriction analysis.
To use this plasmid with bla fusions and increase the functionality of this system, the depositing laboratory replaced the ApR gene as follows.
The ApR gene flanked by the remaining BamHI sites was removed and replaced with either CmR, TcR or KmR resistance markers (see associated schematic image).
The KmR or aminoglycoside transferase gene (aphA) was cloned on a BamHI fragment from pUC71-K (Vieira and Messing, 1982) into the BamHI sites to yield pRE118.
The resulting plasmid together with others in this deposited series contain the conditional R6K ori, the origin of transfer (oriT) which allows conjugative transfer from permissive hosts, the sacB1 gene to provide negative selection and a MCS, along with a range of different AbR markers.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRE118 was a gift from Dieter Schifferli (Addgene plasmid # 43830 ; http://n2t.net/addgene:43830 ; RRID:Addgene_43830) -
For your References section:
Improved allelic exchange vectors and their use to analyze 987P fimbria gene expression. Edwards RA, Keller LH, Schifferli DM. Gene. 1998 Jan 30;207(2):149-57. 10.1016/S0378-1119(97)00619-7 PubMed 9511756