Skip to main content

pGPD2
(Plasmid #43972)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 43972 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    p416-GPD
  • Backbone size (bp) 5500
  • Modifications to backbone
    Inserted new multicloning site between CYC promoter and CYC terminator.
  • Vector type
    Bacterial Expression, Yeast Expression, Synthetic Biology
  • Promoter GPD
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer tgttgtgtggaattgtgagc
  • 3′ sequencing primer cgggcctcttcgctattacg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGPD2 was a gift from Hal Alper (Addgene plasmid # 43972 ; http://n2t.net/addgene:43972 ; RRID:Addgene_43972)
  • For your References section:

    Re-engineering multicloning sites for function and convenience. Crook NC, Freeman ES, Alper HS. Nucleic Acids Res. 2011 Aug;39(14):e92. doi: 10.1093/nar/gkr346. Epub 2011 May 17. 10.1093/nar/gkr346 PubMed 21586584