Skip to main content
Addgene

N205 nLV EF-1a-ZFHD1-link-FKBP-HA <T2A> HP1aCS-Frbx2-V5-PGK-Blast
(Plasmid #44017)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 44017 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    N103
  • Backbone size w/o insert (bp) 8600
  • Vector type
    Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    FKBP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    321
  • Promoter EF-1a
  • Tags / Fusion Proteins
    • HA (C terminal on insert)
    • ZFHD1 (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GGCACTTGATGTAATTCTCCTTG
  • 3′ sequencing primer gtggatgtggaatgtgtgcga
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Cbx5
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    357
  • Mutation
    N-term chromo domain removed
  • Entrez Gene
    Cbx5 (a.k.a. 2610029O15Rik, HP1, Hp1a, Hp1alpha)
  • Promoter EF-1a
  • Tags / Fusion Proteins
    • Frb (C terminal on insert)
    • Hu Frb x2(WT Frb+codon Wobble Frb) (C terminal on insert)
    • V5/epitope (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GGCACTTGATGTAATTCTCCTTG
  • 3′ sequencing primer gtggatgtggaatgtgtgcga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    N205 nLV EF-1a-ZFHD1-link-FKBP-HA <T2A> HP1aCS-Frbx2-V5-PGK-Blast was a gift from Jerry Crabtree (Addgene plasmid # 44017 ; http://n2t.net/addgene:44017 ; RRID:Addgene_44017)
  • For your References section:

    Dynamics and memory of heterochromatin in living cells. Hathaway NA, Bell O, Hodges C, Miller EL, Neel DS, Crabtree GR. Cell. 2012 Jun 22;149(7):1447-60. doi: 10.1016/j.cell.2012.03.052. Epub 2012 Jun 14. 10.1016/j.cell.2012.03.052 PubMed 22704655