-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 44272 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepN1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3941
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePAiRFP1
-
Alt namePhotoactivatable iRFP1
-
SpeciesSynthetic
-
Insert Size (bp)1545
-
MutationG127D/S141R/M163L/Q168L/A203V/G218S/R220P/V244F/A276V/Y280C/ E294V/H303R/A386V/ A480V/H498Y
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ggtaggcgtgtacggtgggag
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPAiRFP1-N1 was a gift from Vladislav Verkhusha (Addgene plasmid # 44272 ; http://n2t.net/addgene:44272 ; RRID:Addgene_44272) -
For your References section:
Far-red light photoactivatable near-infrared fluorescent proteins engineered from a bacterial phytochrome. Piatkevich KD, Subach FV, Verkhusha VV. Nat Commun. 2013 Jul 10;4:2153. doi: 10.1038/ncomms3153. 10.1038/ncomms3153 PubMed 23842578