pCIG-V5-Snail2-IRES-nls-GFP
(Plasmid
#44282)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44282 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCIG
-
Backbone manufacturerSean Megason and Andrew McMahon
- Backbone size w/o insert (bp) 6240
- Total vector size (bp) 7091
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameV5-Snail2
-
SpeciesG. gallus (chicken)
-
Insert Size (bp)851
-
GenBank IDX77572.1
-
Entrez GeneSNAI2
- Promoter CMV-IE-enhancer and chicken beta-actin promoter
-
Tag
/ Fusion Protein
- V5 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (not destroyed)
- 3′ cloning site Cla1 (not destroyed)
- 5′ sequencing primer tacagctcctgggcaacgtg
- 3′ sequencing primer gcttcggccagtaacgttag (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCIG-V5-Snail2-IRES-nls-GFP was a gift from Martin Cheung (Addgene plasmid # 44282 ; http://n2t.net/addgene:44282 ; RRID:Addgene_44282) -
For your References section:
Phosphorylation of Sox9 is required for neural crest delamination and is regulated downstream of BMP and canonical Wnt signaling. Liu JA, Wu MH, Yan CH, Chau BK, So H, Ng A, Chan A, Cheah KS, Briscoe J, Cheung M. Proc Natl Acad Sci U S A. 2013 Feb 19;110(8):2882-7. doi: 10.1073/pnas.1211747110. Epub 2013 Feb 4. 10.1073/pnas.1211747110 PubMed 23382206