pMX_mTAF3
(Plasmid
#44334)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 44334 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMX
- Total vector size (bp) 7459
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsStandard
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTAF3
-
Alt nameTBP-associated factor 3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2797
-
GenBank IDNM_027748.3
-
Entrez GeneTaf3 (a.k.a. 140kDa, 4933439M23Rik, AW539625, TAF140, TAFII-140, TAFII140, mTAFII140)
- Promoter LTR
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site Xho1 (not destroyed)
- 5′ sequencing primer TACACGCCGCCCACGTGAAGGC
- 3′ sequencing primer unknown
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTaken from: pxj4l-mTAF3-flag (Gangloff et al., MCB 21: 5109 (2001)) Kindly provided by drs. Mengus and Davidson
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMX_mTAF3 was a gift from Marc Timmers (Addgene plasmid # 44334 ; http://n2t.net/addgene:44334 ; RRID:Addgene_44334) -
For your References section:
A central role for TFIID in the pluripotent transcription circuitry. Pijnappel WW, Esch D, Baltissen MP, Wu G, Mischerikow N, Bergsma AJ, van der Wal E, Han DW, Bruch Hv, Moritz S, Lijnzaad P, Altelaar AF, Sameith K, Zaehres H, Heck AJ, Holstege FC, Scholer HR, Timmers HT. Nature. 2013 Mar 28;495(7442):516-9. doi: 10.1038/nature11970. Epub 2013 Mar 17. 10.1038/nature11970 PubMed 23503660