Skip to main content
Addgene

pGreenII 0579-1 (35S::LUC)
(Plasmid #44468)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 44468 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGreenII 0000
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 5544
  • Vector type
    Plant Transformation

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    A luciferase gene
  • Alt name
    LUC
  • Alt name
    Firefly-derived Luciferase
  • Species
    Synthetic
  • Promoter 35S Promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site HpaI (destroyed during cloning)
  • 5′ sequencing primer RAJ-198 (CTTAGTTTACCCGCCAATATATCCTGTCA)
  • 3′ sequencing primer RAJ-199 (AGATCTTGGCAGGATATATTGTGGTGTAAC)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This plasmid was derived from pGreenII 0800, which was obtained from Roger P. Hellens from the New Zealand Institute for Plant Breeding Research Limited
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Reference: Johnson RA, Hellens RP, Love DR (2011) A transient assay for recombination demonstrates that Arabidopsis SNM1 and XRCC3 enhance non-homologous recombination. Genetics and Molecular Research 10 (3):2104-2132. doi:10.4238/vol10-3gmr1347

Please note that Addgene identified an IS4 transposable element in a small percentage of the stock of this plasmid. Please select multiple colonies to isolate the plasmid without the insertion.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGreenII 0579-1 (35S::LUC) was a gift from Roger Hellens (Addgene plasmid # 44468 ; http://n2t.net/addgene:44468 ; RRID:Addgene_44468)