pGreenII 0579-1 (35S::LUC)
(Plasmid
#44468)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44468 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGreenII 0000
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 5544
-
Vector typePlant Transformation
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameA luciferase gene
-
Alt nameLUC
-
Alt nameFirefly-derived Luciferase
-
SpeciesSynthetic
- Promoter 35S Promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site HpaI (destroyed during cloning)
- 5′ sequencing primer RAJ-198 (CTTAGTTTACCCGCCAATATATCCTGTCA)
- 3′ sequencing primer RAJ-199 (AGATCTTGGCAGGATATATTGTGGTGTAAC) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was derived from pGreenII 0800, which was obtained from Roger P. Hellens from the New Zealand Institute for Plant Breeding Research Limited
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Reference: Johnson RA, Hellens RP, Love DR (2011) A transient assay for recombination demonstrates that Arabidopsis SNM1 and XRCC3 enhance non-homologous recombination. Genetics and Molecular Research 10 (3):2104-2132. doi:10.4238/vol10-3gmr1347
Please note that Addgene identified an IS4 transposable element in a small percentage of the stock of this plasmid. Please select multiple colonies to isolate the plasmid without the insertion.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGreenII 0579-1 (35S::LUC) was a gift from Roger Hellens (Addgene plasmid # 44468 ; http://n2t.net/addgene:44468 ; RRID:Addgene_44468)