Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pK7WGF2::hCas9
(Plasmid #46965)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 46965 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pK7WGF2
  • Backbone size w/o insert (bp) 10257
  • Total vector size (bp) 14397
  • Vector type
    CRISPR ; Plant expression
  • Selectable markers
    Kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    hCas9
  • Species
    Synthetic
  • Insert Size (bp)
    4140
  • Promoter 35S
  • Tag / Fusion Protein
    • eGFP (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CAGGCTCCGCGGCCGC
  • 3′ sequencing primer TTGTACAAGAAAGCTGGGTCG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Addgene Plasmid 41815: hCas9
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For more information on Kamoun Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Kamoun/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pK7WGF2::hCas9 was a gift from Sophien Kamoun (Addgene plasmid # 46965 ; http://n2t.net/addgene:46965 ; RRID:Addgene_46965)
  • For your References section:

    Targeted mutagenesis in the model plant Nicotiana benthamiana using Cas9 RNA-guided endonuclease. Nekrasov V, Staskawicz B, Weigel D, Jones JD, Kamoun S. Nat Biotechnol. 2013 Aug 8;31(8):691-3. doi: 10.1038/nbt.2655. 10.1038/nbt.2655 PubMed 23929340