Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pICSL01009::AtU6p
(Plasmid #46968)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 46968 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pICSL01009
  • Backbone size w/o insert (bp) 2243
  • Total vector size (bp) 2323
  • Vector type
    Plant Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AtU6p
  • Species
    Synthetic
  • Insert Size (bp)
    80

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bsa I (not destroyed)
  • 3′ cloning site Bsa I (not destroyed)
  • 5′ sequencing primer CGTTATCCCCTGATTCTGTGGATAAC
  • 3′ sequencing primer GTCTCATGAGCGGATACATATTTGAATG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The backbone of the plasmid is a modified backbone of a level 0 vector from Weber et al. (PLoS One 6:e16765, 2011)

For more information on Kamoun Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Kamoun/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pICSL01009::AtU6p was a gift from Sophien Kamoun (Addgene plasmid # 46968 ; http://n2t.net/addgene:46968 ; RRID:Addgene_46968)
  • For your References section:

    Targeted mutagenesis in the model plant Nicotiana benthamiana using Cas9 RNA-guided endonuclease. Nekrasov V, Staskawicz B, Weigel D, Jones JD, Kamoun S. Nat Biotechnol. 2013 Aug 8;31(8):691-3. doi: 10.1038/nbt.2655. 10.1038/nbt.2655 PubMed 23929340