pGreenII 0579-1 (35S::LUC)
(Plasmid
#44468)
-
Depositing Lab
-
Depositing OrganizationNew Zealand Institute for Plant & Food Research
Located in New Zealand -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 44468 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 44468-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 44468-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGreenII 0000
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 5544
-
Vector typePlant Transformation
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameA luciferase gene
-
Alt nameLUC
-
Alt nameFirefly-derived Luciferase
-
SpeciesSynthetic
- Promoter 35S Promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site HpaI (destroyed during cloning)
- 5′ sequencing primer RAJ-198 (CTTAGTTTACCCGCCAATATATCCTGTCA)
- 3′ sequencing primer RAJ-199 (AGATCTTGGCAGGATATATTGTGGTGTAAC)
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was derived from pGreenII 0800, which was obtained from Roger P. Hellens from the New Zealand Institute for Plant Breeding Research Limited
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Reference: Johnson RA, Hellens RP, Love DR (2011) A transient assay for recombination demonstrates that Arabidopsis SNM1 and XRCC3 enhance non-homologous recombination. Genetics and Molecular Research 10 (3):2104-2132. doi:10.4238/vol10-3gmr1347
Please note that Addgene identified an IS4 transposable element in a small percentage of the stock of this plasmid. Please select multiple colonies to isolate the plasmid without the insertion.
DNA (Catalog # 44468-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 44468-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGreenII 0579-1 (35S::LUC) was a gift from Roger Hellens (Addgene plasmid # 44468 ; http://n2t.net/addgene:44468 ; RRID:Addgene_44468)