Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #44509)


Item Catalog # Description Quantity Price (USD)
Plasmid 44509 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4274
  • Total vector size (bp) 5958
  • Modifications to backbone
    CYC1 transcriptional terminator present downstream of inserts (between XhoI and PvuII sites). Additional, nonfunctional tetracycline repressor (tetR) fragment present between SacI and SpeI sites.
  • Vector type
    Yeast Expression, Synthetic Biology ; Expression regulator/reporter
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    PGal1-D12 promoter
  • Alt name
    Yeast GAL1 promoter with 2XtetO2
  • Species
    S. cerevisiae (budding yeast), Synthetic
  • Insert Size (bp)
  • Mutation
    Two tandem tet operators (2XtetO2) downstream of the GAL1 TATA box
  • Entrez Gene
    GAL1 (a.k.a. YBR020W)
  • Promoter PGal1-D12 promoter

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer Gal1ProF2 (CGAAGCGATGATTTTTGATC)
  • 3′ sequencing primer Tet-R (GGCGAGTTTACGGGTTGTTA)
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Alt name
    Tetracycline repressor
  • Species
    Synthetic; E. Coli
  • Insert Size (bp)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GAL1
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDN-G1Tt was a gift from Gabor Balazsi (Addgene plasmid # 44509 ; ; RRID:Addgene_44509)
  • For your References section:

    Negative autoregulation linearizes the dose-response and suppresses the heterogeneity of gene expression. Nevozhay D, Adams RM, Murphy KF, Josic K, Balazsi G. Proc Natl Acad Sci U S A. 2009 Mar 31;106(13):5123-8. doi: 10.1073/pnas.0809901106. Epub 2009 Mar 11. 10.1073/pnas.0809901106 PubMed 19279212