Skip to main content
Addgene

pDN-T1GZmbh
(Plasmid #44522)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 44522 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRS403
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4456
  • Total vector size (bp) 6393
  • Modifications to backbone
    CYC1 transcriptional terminator present downstream of inserts (between XhoI and PvuII sites). Nonfunctional tetracycline repressor (tetR) fragment present between SacI and SpeI sites.
  • Vector type
    Yeast Expression, Synthetic Biology ; Expression regulator/reporter
  • Selectable markers
    Zeocin, HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    PGal1-T123 promoter
  • Alt name
    Yeast GAL1 promoter with 3XtetO2
  • Species
    S. cerevisiae (budding yeast), Synthetic
  • Insert Size (bp)
    450
  • Mutation
    Three tandem tet operators (3XtetO2) downstream of the GAL1 TATA box
  • Entrez Gene
    GAL1 (a.k.a. YBR020W)
  • Promoter PGal1-T123 promoter

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer Gal1ProF2 (CGAAGCGATGATTTTTGATC)
  • 3′ sequencing primer GFP-R
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    yEGFP::ZeoR
  • Alt name
    yeast-enhanced green fluorescent protein
  • Alt name
    Bleomycin/Zeocin resistance protein
  • Species
    S. cerevisiae (budding yeast), Synthetic
  • Insert Size (bp)
    1111

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GAL1
  • 3′ sequencing primer Zeo-R (ctgatgaacagggtcacgtc)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDN-T1GZmbh was a gift from Gabor Balazsi (Addgene plasmid # 44522 ; http://n2t.net/addgene:44522 ; RRID:Addgene_44522)
  • For your References section:

    Negative autoregulation linearizes the dose-response and suppresses the heterogeneity of gene expression. Nevozhay D, Adams RM, Murphy KF, Josic K, Balazsi G. Proc Natl Acad Sci U S A. 2009 Mar 31;106(13):5123-8. doi: 10.1073/pnas.0809901106. Epub 2009 Mar 11. 10.1073/pnas.0809901106 PubMed 19279212