pGL4.75-KRAS LCS6m
(Plasmid
#44571)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44571 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGL4.75
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4281
- Total vector size (bp) 8181
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKRAS 3'UTR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3900
-
MutationThe T allele at LCS6 (let-7 complementary site 6) was changed to the G allele (rs61764370 T>G)
-
GenBank IDNM_004985.3
-
Entrez GeneKRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xba1 (destroyed during cloning)
- 3′ cloning site xba1 (destroyed during cloning)
- 5′ sequencing primer TGACACAGGGAGACTACATTTAATTC
- 3′ sequencing primer GCCTGAACTAGTTCACAGACAAGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A substitute for pGL3-KRAS LCS6m in Chin et al., 2008.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL4.75-KRAS LCS6m was a gift from Frank Slack (Addgene plasmid # 44571 ; http://n2t.net/addgene:44571 ; RRID:Addgene_44571)