Skip to main content

pBa.TfR.GFP
(Plasmid #45060)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45060 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBa-eGFP
  • Backbone size w/o insert (bp) 6755
  • Total vector size (bp) 9031
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TfR
  • Alt name
    human transferrin receptor
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2276
  • GenBank ID
    M11507
  • Entrez Gene
    TFRC (a.k.a. CD71, IMD46, T9, TFR, TFR1, TR, TRFR, p90)
  • Promoter Chicken Beta Actin
  • Tag / Fusion Protein
    • GFP (C terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TTCGGCTTCTGGCGTGTGAC
  • 3′ sequencing primer GTGGTTTGTCCAAACTCATC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Kif 5c received from Caroine Enns, Oregon Health & Science University
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination.
XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBa.TfR.GFP was a gift from Gary Banker & Marvin Bentley (Addgene plasmid # 45060 ; http://n2t.net/addgene:45060 ; RRID:Addgene_45060)
  • For your References section:

    The role of selective transport in neuronal protein sorting. Burack MA, Silverman MA, Banker G. Neuron. 2000 May;26(2):465-72. 10.1016/S0896-6273(00)81178-2 PubMed 10839364