Skip to main content

pcDNA3.2/DEST/hTfR-HA
(Plasmid #69610)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69610 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 69610-D50 50 μg of DNA in Tris buffer $495
DNA 69610-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA3.2-HA/Dest (converted from pcDNA3.2-V5/Dest)
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 7699
  • Total vector size (bp) 7771
  • Modifications to backbone
    pcDNA3.2-V5/Dest was converted to pcDNA3.2-HA/Dest by first introducing unique NotI and XhoI sites by sire-directed mutagenesis, followed by ligation of annealed HA-stop peptide.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human transferrin receptor
  • Alt name
    TfR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2283
  • GenBank ID
    BC001188
  • Entrez Gene
    TFRC (a.k.a. CD71, IMD46, T9, TFR, TFR1, TR, TRFR, p90)
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (C terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer T7 forward primer
  • 3′ sequencing primer TfR internal primer (5' CGCTGCCAGCTTTACTGGAG 3')
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.2/DEST/hTfR-HA was a gift from Robin Shaw (Addgene plasmid # 69610 ; http://n2t.net/addgene:69610 ; RRID:Addgene_69610)
  • For your References section:

    Actin cytoskeleton rest stops regulate anterograde traffic of connexin 43 vesicles to the plasma membrane. Smyth JW, Vogan JM, Buch PJ, Zhang SS, Fong TS, Hong TT, Shaw RM. Circ Res. 2012 Mar 30;110(7):978-89. Epub 2012 Feb 9. 10.1161/CIRCRESAHA.111.257964 PubMed 22328533