-
Purposehuman transferrin receptor with an HA tag fused at the C-terminus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69610 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.2-HA/Dest (converted from pcDNA3.2-V5/Dest)
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 7699
- Total vector size (bp) 7771
-
Modifications to backbonepcDNA3.2-V5/Dest was converted to pcDNA3.2-HA/Dest by first introducing unique NotI and XhoI sites by sire-directed mutagenesis, followed by ligation of annealed HA-stop peptide.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman transferrin receptor
-
Alt nameTfR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2283
-
GenBank IDBC001188
-
Entrez GeneTFRC (a.k.a. CD71, IMD46, T9, TFR, TFR1, TR, TRFR, p90)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (C terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer T7 forward primer
- 3′ sequencing primer TfR internal primer (5' CGCTGCCAGCTTTACTGGAG 3') (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.2/DEST/hTfR-HA was a gift from Robin Shaw (Addgene plasmid # 69610 ; http://n2t.net/addgene:69610 ; RRID:Addgene_69610) -
For your References section:
Actin cytoskeleton rest stops regulate anterograde traffic of connexin 43 vesicles to the plasma membrane. Smyth JW, Vogan JM, Buch PJ, Zhang SS, Fong TS, Hong TT, Shaw RM. Circ Res. 2012 Mar 30;110(7):978-89. Epub 2012 Feb 9. 10.1161/CIRCRESAHA.111.257964 PubMed 22328533