pKG209
(Plasmid
#45109)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 45109 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepIC242
- Backbone size w/o insert (bp) 6000
-
Modifications to backbonepIC242 backbone, insert has been codon optimized
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCENP-T (aa1-374) Laci-NLS
-
SpeciesH. sapiens (human)
-
Entrez GeneCENPT (a.k.a. C16orf56, CENP-T, SSMGA)
-
Tags
/ Fusion Proteins
- GFP (N terminal on backbone)
- tev (N terminal on backbone)
- s peptide (N terminal on insert)
- Laci-NLS (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (unknown if destroyed)
- 3′ cloning site EcoR1/Sac11 (unknown if destroyed)
- 5′ sequencing primer GGCATGGACGAGCTGTACAAG
- 3′ sequencing primer GCATTCATTTTATGTTTCAGG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKG209 was a gift from Iain Cheeseman (Addgene plasmid # 45109 ; http://n2t.net/addgene:45109 ; RRID:Addgene_45109) -
For your References section:
Induced ectopic kinetochore assembly bypasses the requirement for CENP-A nucleosomes. Gascoigne KE, Takeuchi K, Suzuki A, Hori T, Fukagawa T, Cheeseman IM. Cell. 2011 Apr 29;145(3):410-22. doi: 10.1016/j.cell.2011.03.031. 10.1016/j.cell.2011.03.031 PubMed 21529714