pETCON-DnvLB16
(Plasmid
#45124)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 45124 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepETCON
- Backbone size w/o insert (bp) 6287
- Total vector size (bp) 6644
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDnvLB16
-
SpeciesSynthetic
-
Insert Size (bp)357
- Promoter GAL
-
Tags
/ Fusion Proteins
- c-myc epitope tag (C terminal on backbone)
- Aga2p for yeast surface display (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer None
- 3′ sequencing primer cgagctaaaagtacagtggg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pETCON-DnvLB16 was a gift from David Baker (Addgene plasmid # 45124 ; http://n2t.net/addgene:45124 ; RRID:Addgene_45124) -
For your References section:
Computational design of a protein-based enzyme inhibitor. Procko E, Hedman R, Hamilton K, Seetharaman J, Fleishman SJ, Su M, Aramini J, Kornhaber G, Hunt JF, Tong L, Montelione GT, Baker D. J Mol Biol. 2013 Sep 23;425(18):3563-75. doi: 10.1016/j.jmb.2013.06.035. 10.1016/j.jmb.2013.06.035 PubMed 23827138