Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCMV-Klb-EGFP
(Plasmid #45531)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 45531 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCR3
  • Backbone size w/o insert (bp) 4986
  • Total vector size (bp) 8850
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin, 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    beta Klotho
  • Alt name
    Klb
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3143
  • GenBank ID
    NM_031180
  • Entrez Gene
    Klb (a.k.a. AV071179, betaKlotho)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer cgtcgccgtccagctcgaccag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This plasmid was developed by Michael Phelps during his postdoctoral research at the Yablonka-Reuveni lab.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-Klb-EGFP was a gift from Zipora Yablonka-Reuveni (Addgene plasmid # 45531 ; http://n2t.net/addgene:45531 ; RRID:Addgene_45531)
  • For your References section:

    Expression profile and overexpression outcome indicate a role for betaKlotho in skeletal muscle fibro/adipogenesis. Phelps M, Stuelsatz P, Yablonka-Reuveni Z. FEBS J. 2016 May;283(9):1653-68. doi: 10.1111/febs.13682. Epub 2016 Apr 13. 10.1111/febs.13682 PubMed 26881702