Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #45532)


Item Catalog # Description Quantity Price (USD)
Plasmid 45532 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5710
  • Total vector size (bp) 8760
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    alpha Klotho
  • Alt name
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    Kl (a.k.a. alpha-kl)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer cgtcgccgtccagctcgaccag
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-Kl-EGFP was a gift from Zipora Yablonka-Reuveni (Addgene plasmid # 45532 ; ; RRID:Addgene_45532)
  • For your References section:

    Expression profile and overexpression outcome indicate a role for betaKlotho in skeletal muscle fibro/adipogenesis. Phelps M, Stuelsatz P, Yablonka-Reuveni Z. FEBS J. 2016 May;283(9):1653-68. doi: 10.1111/febs.13682. Epub 2016 Apr 13. 10.1111/febs.13682 PubMed 26881702