Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCVL.Active/Repressed TLR (Sce)
(Plasmid #45575)


Item Catalog # Description Quantity Price (USD)
Plasmid 45575 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4483
  • Total vector size (bp) 8155
  • Vector type
    Mammalian Expression, Bacterial Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    eGFP with I-Sce I TS
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    embedded I-Sce I TS from 163-185
  • Promoter SFFV
  • Tags / Fusion Proteins
    • iRFP (N terminal on insert)
    • T2A dislinker (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer SFFVpro-F (CTTCTGCTTCCCGAGCTCTA)
  • 3′ sequencing primer mCherry-R
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    +3 mCherry
  • Insert Size (bp)

Cloning Information for Gene/Insert 2

Resource Information

Terms and Licenses

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCVL.Active/Repressed TLR (Sce) was a gift from Andrew Scharenberg (Addgene plasmid # 45575 ; ; RRID:Addgene_45575)
  • For your References section:

    Novel fluorescent genome editing reporters for monitoring DNA repair pathway utilization at endonuclease-induced breaks. Kuhar R, Gwiazda KS, Humbert O, Mandt T, Pangallo J, Brault M, Khan I, Maizels N, Rawlings DJ, Scharenberg AM, Certo MT. Nucleic Acids Res. 2013 Oct 10. 10.1093/nar/gkt872 PubMed 24121685