Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLenti-lxlplap
(Plasmid #45581)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 45581 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFUGW
  • Backbone size w/o insert (bp) 9182
  • Total vector size (bp) 12120
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl2
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Green fluorescent protein
  • Alt name
    EGFP
  • Insert Size (bp)
    1170
  • Promoter Ubiquitin
  • Tag / Fusion Protein
    • Histone 2B (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer ACTAGTAAATTGTCCGCTAAATTCTG
  • 3′ sequencing primer CTGTGCGGGGTCAAGGGCAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Placental alkaline phosphatase
  • Alt name
    PLAP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1590
  • Entrez Gene
    ALPP (a.k.a. ALP, ALPI, IAP, PALP, PLAP, PLAP-1)

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer GCAGAAGAACGGCATCAAGGTGAAC
  • 3′ sequencing primer GTGGATACGCTGCTTT
  • (Common Sequencing Primers)

Terms and Licenses

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-lxlplap was a gift from Nirao Shah (Addgene plasmid # 45581 ; http://n2t.net/addgene:45581 ; RRID:Addgene_45581)
  • For your References section:

    Sexually dimorphic neurons in the ventromedial hypothalamus govern mating in both sexes and aggression in males. Yang CF, Chiang MC, Gray DC, Prabhakaran M, Alvarado M, Juntti SA, Unger EK, Wells JA, Shah NM. Cell. 2013 May 9;153(4):896-909. doi: 10.1016/j.cell.2013.04.017. 10.1016/j.cell.2013.04.017 PubMed 23663785