Skip to main content
Addgene

pCRII-Topo Crim1 in situ probe
(Plasmid #45600)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45600 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCRII-Topo
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 4400
  • Vector type
    in situ

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Crim1 in situ probe
  • Alt name
    cysteine rich transmembrane BMP regulator 1 (chordin like)
  • Alt name
    Crim1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    440
  • Mutation
    insert contains bp#4062-4502 of NM_015800.3
  • GenBank ID
    NM_015800 XM_128751
  • Entrez Gene
    Crim1 (a.k.a. AU015004)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Fragment was amplified using the following primers:
TCTCAAGACTGTTGGTTGCTG
TGAACAACCAATGATAGCACAG

For in vitro transcription, use the NotI restriction digest and SP6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation.

Please note that Addgene's sequencing results match bp#4062-4502 of NM_015800.3, not bp# 4708-5148 as indicated on plasmid map. The plasmid functions as described in the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRII-Topo Crim1 in situ probe was a gift from Jeffrey Macklis (Addgene plasmid # 45600 ; http://n2t.net/addgene:45600 ; RRID:Addgene_45600)
  • For your References section:

    Neuronal subtype-specific genes that control corticospinal motor neuron development in vivo. Arlotta P, Molyneaux BJ, Chen J, Inoue J, Kominami R, Macklis JD. Neuron. 2005 Jan 20;45(2):207-21. 10.1016/j.neuron.2004.12.036 PubMed 15664173