Skip to main content

pCRII-Topo Diap3 in situ probe
(Plasmid #45602)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45602 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCRII-Topo
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 4700
  • Vector type
    in situ

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Diap3 in situ probe
  • Alt name
    Diap3
  • Alt name
    diaphanous homolog 3 (Drosophila)
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    695
  • Mutation
    fragment contains bp# 1589-2321 of BC028920
  • GenBank ID
    BC028920
  • Entrez Gene
    Diaph3 (a.k.a. 4930417P13Rik, Dia2, Diap3, Drf3, p134MDia2)

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Fragment was amplified using the following primers:
AGCAGTTCGCTGTTGTGATG
GCACGTTTCTCCTTTTCTGC

For in vitro transcription, use the SpeI restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation.

Please note that Addgene's sequencing results match bp# 1589-2321 of BC028920, not bp# 1610-2321 as indicated on plasmid map. The plasmid functions as described in the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRII-Topo Diap3 in situ probe was a gift from Jeffrey Macklis (Addgene plasmid # 45602 ; http://n2t.net/addgene:45602 ; RRID:Addgene_45602)
  • For your References section:

    Neuronal subtype-specific genes that control corticospinal motor neuron development in vivo. Arlotta P, Molyneaux BJ, Chen J, Inoue J, Kominami R, Macklis JD. Neuron. 2005 Jan 20;45(2):207-21. 10.1016/j.neuron.2004.12.036 PubMed 15664173