Skip to main content

pCRII-Topo Foxp2 in situ probe
(Plasmid #45620)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45620 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCRII-Topo
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 4400
  • Vector type
    in situ

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Foxp2 in situ probe
  • Alt name
    Foxp2
  • Alt name
    forkhead-related transcription factor 2
  • Species
    M. musculus (mouse)
  • Mutation
    fragment contains bp#1709-2142 of AF339106
  • GenBank ID
    AF339106
  • Entrez Gene
    Foxp2 (a.k.a. 2810043D05Rik, CAG-16, D0Kist7)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The Fox2p fragment was amplified by RT-PCR using the following primer pair:
CAGTGTGGACTGTGGACGAA
TTCCAGGTCCTCAGATAAAGG

For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation.

Please note that Addgene's sequencing results match bp#1709-2142 of AF339106, not bp# 1707-2142 as indicated on plasmid map. The plasmid functions as described in the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRII-Topo Foxp2 in situ probe was a gift from Jeffrey Macklis (Addgene plasmid # 45620 ; http://n2t.net/addgene:45620 ; RRID:Addgene_45620)
  • For your References section:

    Fezl is required for the birth and specification of corticospinal motor neurons. Molyneaux BJ, Arlotta P, Hirata T, Hibi M, Macklis JD. Neuron. 2005 Sep 15;47(6):817-31. 10.1016/j.neuron.2005.08.030 PubMed 16157277