Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCRII-Topo Plexin D1 in situ probe
(Plasmid #45621)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 45621 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCRII-Topo
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 4600
  • Vector type
    in situ

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Plexin D1 in situ probe
  • Alt name
    Plexin D1
  • Alt name
    Plxnd1
  • Species
    M. musculus (mouse)
  • Mutation
    fragment contains bp# 5751-6406 of NM_026376.3
  • GenBank ID
    NM_026376
  • Entrez Gene
    Plxnd1 (a.k.a. 6230425C21Rik, b2b1863Clo, b2b553Clo)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The Plexin D1 fragment was amplified by RT-PCR using the following primer pair:
CAGGAAATGAACGCACACC
TGAGGGACACAGACAACTGC;
For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRII-Topo Plexin D1 in situ probe was a gift from Jeffrey Macklis (Addgene plasmid # 45621 ; http://n2t.net/addgene:45621 ; RRID:Addgene_45621)
  • For your References section:

    Fezl is required for the birth and specification of corticospinal motor neurons. Molyneaux BJ, Arlotta P, Hirata T, Hibi M, Macklis JD. Neuron. 2005 Sep 15;47(6):817-31. 10.1016/j.neuron.2005.08.030 PubMed 16157277