pBEST-PLlacO-1-UTR1-deCFP-T500
(Plasmid
#45777)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45777 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBEST-Luc
-
Backbone manufacturerPromega
-
Modifications to backbonepTacI promoter was removed and replaced by PLlacO-1. Untranslated region was removed and replaced by UTR1, a powerful UTR. Luc gene (firefly Luciferase) was removed and replaced by deCFP. A transcriptional terminator was added, called T500.
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedeCFP
-
SpeciesSynthetic
-
Insert Size (bp)678
- Promoter PLlacO-1
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CATGGTGAAGACTATCGCAC
- 3′ sequencing primer GAAGGAGCTGACTGGGTTGA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byVincent Noireaux, University of Minnesota
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBEST-PLlacO-1-UTR1-deCFP-T500 was a gift from Richard Murray (Addgene plasmid # 45777 ; http://n2t.net/addgene:45777 ; RRID:Addgene_45777)