Skip to main content

pBabe HA-Runx1-neo
(Plasmid #45815)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45815 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBabe neo
  • Backbone manufacturer
    Weinberg Lab (Addgene plasmid 1767)
  • Backbone size w/o insert (bp) 5300
  • Total vector size (bp) 6600
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Runx1
  • Alt name
    AML1
  • Alt name
    runt related transcription factor 1
  • Alt name
    Cbfa2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1347
  • GenBank ID
    NM_0011110022
  • Entrez Gene
    Runx1 (a.k.a. AML1, CBF-alpha-2, Cbfa2, Pebp2a2, Pebpa2b)
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer pBABE 5'
  • 3′ sequencing primer pBABE 3'
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pBabe HA-Runx1 neo was constructed by PCR using a mouse Runx1 template (Open Biosystems) and the following primers: GCGCAGATCTATGTACCCATACGACGTCCCAGACTACGCTGCTTCAGACAGCATTTTTGAGTC (forward), GCGCGAATTCTCAGAAGCATTCACAGTTTCC (reverse).
The PCR product was gel purified, digested with BglII and EcoRI, and then ligated into pBabe neo, which had been digested with BamHI and EcoRI and then dephosphorylated.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBabe HA-Runx1-neo was a gift from Kevin Janes (Addgene plasmid # 45815 ; http://n2t.net/addgene:45815 ; RRID:Addgene_45815)
  • For your References section:

    Intersection of FOXO- and RUNX1-mediated gene expression programs in single breast epithelial cells during morphogenesis and tumor progression. Wang L, Brugge JS, Janes KA. Proc Natl Acad Sci U S A. 2011 Oct 4;108(40):E803-12. doi: 10.1073/pnas.1103423108. Epub 2011 Aug 22. 10.1073/pnas.1103423108 PubMed 21873240