-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 45815 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBabe neo
-
Backbone manufacturerWeinberg Lab (Addgene plasmid 1767)
- Backbone size w/o insert (bp) 5300
- Total vector size (bp) 6600
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRunx1
-
Alt nameAML1
-
Alt namerunt related transcription factor 1
-
Alt nameCbfa2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1347
-
GenBank IDNM_0011110022
-
Entrez GeneRunx1 (a.k.a. AML1, CBF-alpha-2, Cbfa2, Pebp2a2, Pebpa2b)
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer pBABE 5'
- 3′ sequencing primer pBABE 3'
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pBabe HA-Runx1 neo was constructed by PCR using a mouse Runx1 template (Open Biosystems) and the following primers: GCGCAGATCTATGTACCCATACGACGTCCCAGACTACGCTGCTTCAGACAGCATTTTTGAGTC (forward), GCGCGAATTCTCAGAAGCATTCACAGTTTCC (reverse).
The PCR product was gel purified, digested with BglII and EcoRI, and then ligated into pBabe neo, which had been digested with BamHI and EcoRI and then dephosphorylated.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBabe HA-Runx1-neo was a gift from Kevin Janes (Addgene plasmid # 45815 ; http://n2t.net/addgene:45815 ; RRID:Addgene_45815) -
For your References section:
Intersection of FOXO- and RUNX1-mediated gene expression programs in single breast epithelial cells during morphogenesis and tumor progression. Wang L, Brugge JS, Janes KA. Proc Natl Acad Sci U S A. 2011 Oct 4;108(40):E803-12. doi: 10.1073/pnas.1103423108. Epub 2011 Aug 22. 10.1073/pnas.1103423108 PubMed 21873240