-
Purpose(Empty Backbone)
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 45983 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepOSIP
- Backbone size (bp) 6474
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DB3.1
-
Growth instructionsContains ccdB, so must be grown in a strain resistant to this product (e.g. DB3.1). Growth a 30C to repress expression of the integrase.
-
Copy numberHigh Copy
Cloning Information
- 5′ sequencing primer TAAACTGCCAGGAATTGGGGATC
- 3′ sequencing primer GAAACGCAAAAAGGCCATCCGTC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPlasmid was in part derived from: Haldimann, A. & Wanner, B. L. Conditional-replication, integration, excision, and retrieval plasmid-host systems for gene structure-function studies of bacteria. J. Bacteriol. 183, 6384–6393 (2001).
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Reference:
St-Pierre F, Cui L et al., "One-step cloning and chromosomal integration of DNA", ACS Synthetic Biology, http://pubs.acs.org/doi/abs/10.1021/sb400021j
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOSIP-KH (KanR, HK022) was a gift from Drew Endy & Keith Shearwin (Addgene plasmid # 45983 ; http://n2t.net/addgene:45983 ; RRID:Addgene_45983) -
For your References section:
One-step cloning and chromosomal integration of DNA. St-Pierre F, Cui L, Priest DG, Endy D, Dodd IB, Shearwin KE. ACS Synth Biol. 2013 Sep 20;2(9):537-41. doi: 10.1021/sb400021j. Epub 2013 May 20. 10.1021/sb400021j PubMed 24050148