Skip to main content

pMUH_unc84_2XGFP
(Plasmid #46023)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46023 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJFRC-MUH
  • Backbone manufacturer
    Barret Pfeiffer
  • Backbone size w/o insert (bp) 7800
  • Total vector size (bp) 13300
  • Vector type
    10XUAS-phi31-expression vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    UNC-84
  • Insert Size (bp)
    5500
  • Mutation
    Two amino acid mutations (F279L and L500P) compared to GenBank ref seq NP_001024707.1
  • Entrez Gene
    unc-84 (a.k.a. CELE_F54B11.3)
  • Promoter 10XUAS
  • Tag / Fusion Protein
    • 2XGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer MUHU2: ATAAACAAGCGCAGCTGAACAAGC
  • 3′ sequencing primer MUHD1: AGAATGTTGAGAGTCAGCAGTAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMUH_unc84_2XGFP was a gift from Sean Eddy (Addgene plasmid # 46023 ; http://n2t.net/addgene:46023 ; RRID:Addgene_46023)
  • For your References section:

    Cell type-specific genomics of Drosophila neurons. Henry GL, Davis FP, Picard S, Eddy SR. Nucleic Acids Res. 2012 Oct;40(19):9691-704. doi: 10.1093/nar/gks671. Epub 2012 Aug 1. 10.1093/nar/gks671 PubMed 22855560