-
PurposeOrange intensiometric genetically encoded Ca2+-indicators for optical imaging
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 46025 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCustomized Vector
- Backbone size w/o insert (bp) 3200
- Total vector size (bp) 4454
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameO-GECO1
-
SpeciesSynthetic
-
Insert Size (bp)1254
-
MutationR-GECO1 N45I/A73V/S142P/M146R/M223T/M339L/K378R/E386V/K397N
-
GenBank IDKF186683
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-O-GECO1 was a gift from Robert Campbell (Addgene plasmid # 46025 ; http://n2t.net/addgene:46025 ; RRID:Addgene_46025) -
For your References section:
Improved Orange and Red Ca Indicators and Photophysical Considerations for Optogenetic Applications. Wu J, Liu L, Matsuda T, Zhao Y, Rebane A, Drobizhev M, Chang YF, Araki S, Arai Y, March K, Hughes TE, Sagou K, Miyata T, Nagai T, Li WH, Campbell RE. ACS Chem Neurosci. 2013 Mar 19. 10.1021/cn400012b PubMed 23452507