Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pNMHCII-C1-GFP
(Plasmid #46041)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 46041 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-N3
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 10730
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nonmuscle myosin heavy chain II-C, isoform C1
  • Alt name
    NMHCII-C, isoform C1
  • Alt name
    Myh14, isoform C1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    6030
  • GenBank ID
    AY363100 NM_001271540
  • Entrez Gene
    Myh14 (a.k.a. 2400004E04Rik, II-C, NHMCII, NMHC II-C)
  • Promoter CMV immediate early
  • Tag / Fusion Protein
    • GFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CMV-for: CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer EGFP-N: CGTCGCCGTCCAGCTCGACCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNMHCII-C1-GFP was a gift from Robert Adelstein (Addgene plasmid # 46041 ; http://n2t.net/addgene:46041 ; RRID:Addgene_46041)
  • For your References section:

    A specific isoform of nonmuscle myosin II-C is required for cytokinesis in a tumor cell line. Jana SS, Kawamoto S, Adelstein RS. J Biol Chem. 2006 Aug 25;281(34):24662-70. Epub 2006 Jun 21. 10.1074/jbc.M604606200 PubMed 16790446