Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
As of April 1, 2023, we increased some of our prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pattB-synaptobrevin-7-QFBDAD-hsp70
(Plasmid #46115)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 46115 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pattB
  • Backbone size w/o insert (bp) 7400
  • Total vector size (bp) 10623
  • Modifications to backbone
    Introduced synaptobrevin promoter
  • Vector type
    Insect Expression
  • Selectable markers
    white

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    QF#7
  • Alt name
    QF DNA binding domain
  • Alt name
    QF Activation Domain
  • Alt name
    QF2
  • Species
    Synthetic
  • Insert Size (bp)
    1053

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site AatII (not destroyed)
  • 5′ sequencing primer SYBFOR5: TGGAAGACAGTGAAAGAGGC
  • 3′ sequencing primer hsp70REV-SEQ:GCAAACTCACTCCCTGACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pattB-synaptobrevin-7-QFBDAD-hsp70 was a gift from Christopher Potter (Addgene plasmid # 46115 ; http://n2t.net/addgene:46115 ; RRID:Addgene_46115)
  • For your References section:

    Improved and expanded Q-system reagents for genetic manipulations. Riabinina O, Luginbuhl D, Marr E, Liu S, Wu MN, Luo L, Potter CJ. Nat Methods. 2015 Jan 12. doi: 10.1038/nmeth.3250. 10.1038/nmeth.3250 PubMed 25581800