-
PurposeExpression of murine CD8mCherry in insects
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 46164 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepQUASp
- Backbone size w/o insert (bp) 9929
- Total vector size (bp) 11309
-
Vector typeInsect Expression
-
Selectable markerswhite
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemCD8mCherry
-
Alt namemouse CD8
-
Alt namemCherry
-
SpeciesM. musculus (mouse), Synthetic
-
Insert Size (bp)1380
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer TTTGAAAACCGGTGATAGAGCCTG
- 3′ sequencing primer ACCAGGGGATGCTTAATTGTGTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDenise Montell, UC Santa Barbara
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQUASp-mCD8mCherry was a gift from Christopher Potter (Addgene plasmid # 46164 ; http://n2t.net/addgene:46164 ; RRID:Addgene_46164)