Skip to main content

PU6::unc-119_sgRNA
(Plasmid #46169)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46169 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 46169-D50 50 μg of DNA in Tris buffer $495
DNA 46169-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pUC57
  • Backbone size w/o insert (bp) 2641
  • Total vector size (bp) 3481
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    unc-119 targeting sgRNA
  • Alt name
    unc-119
  • Species
    Synthetic
  • Insert Size (bp)
    840
  • Entrez Gene
    unc-119 (a.k.a. CELE_M142.1)
  • Promoter C. elegans U6 snRNA pol III promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer M13 (-40) forward
  • 3′ sequencing primer M13 (-48) reverse
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

gRNA target sequence GAATTTTCTGAAATTAAAGA

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PU6::unc-119_sgRNA was a gift from John Calarco (Addgene plasmid # 46169 ; http://n2t.net/addgene:46169 ; RRID:Addgene_46169)
  • For your References section:

    Heritable genome editing in C. elegans via a CRISPR-Cas9 system. Friedland AE, Tzur YB, Esvelt KM, Colaiacovo MP, Church GM, Calarco JA. Nat Methods. 2013 Jun 30. doi: 10.1038/nmeth.2532. 10.1038/nmeth.2532 PubMed 23817069