-
PurposeCre recombinase expression plasmid for removal of floxed selectable markers in the C. elegans germline
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 47551 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCFJ212
- Backbone size w/o insert (bp) 9539
- Total vector size (bp) 9929
-
Vector typeWorm Expression, Cre/Lox
-
Selectable markersunc-119(+)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)Mach1
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCre Recombinase
-
Alt namenCre
- Promoter eef-1A.1 (eft-3)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TCAGTTGGGAAACACTTTGCT
- 3′ sequencing primer gcttgaaaggattttgcatttatc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe vector backbone, pCFJ212, was received from Addgene. The Cre coding sequence was amplified from pEM3, which was also received from Addgene.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information on Goldstein Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Goldstein/
Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDD104 (Peft-3::Cre) was a gift from Bob Goldstein (Addgene plasmid # 47551 ; http://n2t.net/addgene:47551 ; RRID:Addgene_47551) -
For your References section:
Engineering the Caenorhabditis elegans genome using Cas9-triggered homologous recombination. Dickinson DJ, Ward JD, Reiner DJ, Goldstein B. Nat Methods. 2013 Sep 1. doi: 10.1038/nmeth.2641. 10.1038/nmeth.2641 PubMed 23995389