pDD104 (Peft-3::Cre)
(Plasmid #47551)

• Purpose: Cre recombinase expression plasmid for removal of floxed selectable markers in the C. elegans germline
• Depositing Lab: Bob Goldstein
• Publication: Dickinson et al Nat Methods. 2013 Sep 1. doi: 10.1038/nmeth.2641.

Backbone

• Vector backbone: pCFJ212
• Backbone size w/o insert (bp): 9539
• Total vector size (bp): 9929
• Vector type: Worm Expression, Cre/Lox
• Selectable markers: unc-119(+)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Mach1
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cre Recombinase
• Alt name: nCre
• Promoter: eef-1A.1 (eft-3)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: TCAGTTGGGAAACACTTTGCT
• 3′ sequencing primer: gcttgaaaggattttgcatttatc

Resource Information

• Supplemental Documents:
  • Annotated Sequence (Genbank format)
• A portion of this plasmid was derived from a plasmid made by: The vector backbone, pCFJ212, was received from Addgene. The Cre coding sequence was amplified from pEM3, which was also received from Addgene.
• Articles Citing this Plasmid:
  • 15 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For more information on Goldstein Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Goldstein/

Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3