Skip to main content

pDD122 (Peft-3::Cas9 + ttTi5605 sgRNA)
(Plasmid #47550)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 47550 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCFJ601
  • Backbone size w/o insert (bp) 2300
  • Total vector size (bp) 8132
  • Modifications to backbone
    Generated from pCFJ601 by replacing the Mos1 transposase with Cas9, then inserting the U6 Promoter::sgRNA gene. Cloning method was Gibson Assembly
  • Vector type
    Worm Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Mach1
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Cas9
  • Species
    Synthetic
  • Insert Size (bp)
    4323
  • Mutation
    Codon optimized and with synthetic introns for C. elegans
  • Promoter eef-1A.1 (eft-3)
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • HA (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TCAGTTGGGAAACACTTTGCT
  • 3′ sequencing primer gcttgaaaggattttgcatttatc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    ttTi5605 sgRNA
  • Insert Size (bp)
    100
  • Mutation
    Protospacer targeting a genomic site adjacent to the ttTi5605 Mos1 allele
  • Promoter U6

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer N/A
  • 3′ sequencing primer ggtgtgaaataccgcacaga
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The vector backbone, pCFJ601, was received from Addgene. The insert was synthesized in our lab.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For more information on Goldstein Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Goldstein/

gRNA target sequence atatcagtctgtttcgtaa

Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDD122 (Peft-3::Cas9 + ttTi5605 sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47550 ; http://n2t.net/addgene:47550 ; RRID:Addgene_47550)
  • For your References section:

    Engineering the Caenorhabditis elegans genome using Cas9-triggered homologous recombination. Dickinson DJ, Ward JD, Reiner DJ, Goldstein B. Nat Methods. 2013 Sep 1. doi: 10.1038/nmeth.2641. 10.1038/nmeth.2641 PubMed 23995389