Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

PU6::klp-12_sgRNA
(Plasmid #46170)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 46170 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC57
  • Backbone size w/o insert (bp) 2641
  • Total vector size (bp) 3481
  • Vector type
    Worm Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    klp-12 targeting sgRNA
  • Alt name
    klp-12
  • Species
    Synthetic
  • Insert Size (bp)
    840
  • Entrez Gene
    klp-12 (a.k.a. CELE_T01G1.1a)
  • Promoter C. elegans U6 snRNA pol III promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer M13 (-40) forward
  • 3′ sequencing primer M13 (-48) reverse
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For more information on Calarco Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/calarco/

gRNA target sequence GATCCACAAGTTACAATTGG

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PU6::klp-12_sgRNA was a gift from John Calarco (Addgene plasmid # 46170 ; http://n2t.net/addgene:46170 ; RRID:Addgene_46170)
  • For your References section:

    Heritable genome editing in C. elegans via a CRISPR-Cas9 system. Friedland AE, Tzur YB, Esvelt KM, Colaiacovo MP, Church GM, Calarco JA. Nat Methods. 2013 Jun 30. doi: 10.1038/nmeth.2532. 10.1038/nmeth.2532 PubMed 23817069