Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pGEX-4T-1-p19-T7-EGFPFL
(Plasmid #46310)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 46310 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGEX-4T-1
  • Backbone size w/o insert (bp) 4941
  • Total vector size (bp) 7005
  • Vector type
    Bacterial Expression ; pro-siRNA

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    p19
  • Species
    Tomato bushy stunt virus
  • Insert Size (bp)
    519
  • GenBank ID
    AJ288942
  • Tags / Fusion Proteins
    • GST (N terminal on backbone)
    • 6XHis (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site SacI (unknown if destroyed)
  • 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
  • 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    EGFPFL DNA-1
  • Species
    Synthetic
  • Insert Size (bp)
    720

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer ATGGAACGAGCTATACAAGGA
  • 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    linker
  • Species
    Synthetic
  • Insert Size (bp)
    32

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site SalI (unknown if destroyed)
  • 5′ sequencing primer ATGGAACGAGCTATACAAGGA
  • 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    EGFPFL DNA-2
  • Species
    Synthetic
  • Insert Size (bp)
    720

Cloning Information for Gene/Insert 4

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer ATGGAACGAGCTATACAAGGA
  • 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

IMPORTANT NOTE: Addgene was unable to sequence this plasmid to our usual standards of quality control due to the hairpin nature of the insert.

More information about this plasmid can be found in a Dec. 2013 Nature Protocols paper from the Lieberman lab; PMID: 24177290

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX-4T-1-p19-T7-EGFPFL was a gift from Judy Lieberman (Addgene plasmid # 46310 ; http://n2t.net/addgene:46310 ; RRID:Addgene_46310)
  • For your References section:

    Efficient and specific gene knockdown by small interfering RNAs produced in bacteria. Huang L, Jin J, Deighan P, Kiner E, McReynolds L, Lieberman J. Nat Biotechnol. 2013 Apr;31(4):350-6. doi: 10.1038/nbt.2537. Epub 2013 Mar 10. 10.1038/nbt.2537 PubMed 23475073