pIhh-5A9-LUC
(Plasmid
#46318)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 46318 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLuc reporter vector
-
Backbone manufacturerYang lab
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name5 copies of A9 sequence from Ihh promoter
-
Alt nameindian hedgehog
-
Alt nameIhh
-
Insert Size (bp)135
- Promoter mouse osteocalcin gene 2 promoter
-
Tag
/ Fusion Protein
- luciferase (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer ?
- 3′ sequencing primer LucNrev (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Five copies of the WT A9 (GATCCAAAGGGAATGTTGCC) were inserted upstream of the TATA box (a 16 bp sequence) from the mouse osteocalcin gene 2 promoter (OG2-TATA box), which is followed by the Luc gene.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIhh-5A9-LUC was a gift from Xiangli Yang (Addgene plasmid # 46318 ; http://n2t.net/addgene:46318 ; RRID:Addgene_46318) -
For your References section:
Atf4 regulates chondrocyte proliferation and differentiation during endochondral ossification by activating Ihh transcription. Wang W, Lian N, Li L, Moss HE, Wang W, Perrien DS, Elefteriou F, Yang X. Development. 2009 Dec;136(24):4143-53. doi: 10.1242/dev.043281. Epub 2009 Nov 11. 10.1242/dev.043281 PubMed 19906842
Map uploaded by the depositor.
Map uploaded by the depositor.