Skip to main content
Holiday Schedule: Addgene will be closed November 25th & 26th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about your shipment please contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pTK88_GFP-Anillin
(Plasmid #46354)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 46354 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBABE
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 9259
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Anillin
  • Species
    H. sapiens (human)
  • Mutation
    a1854 is changed to c to disrupt XhoI site without affecting coding amino acid sequence
  • Entrez Gene
    ANLN (a.k.a. FSGS8, Scraps, scra)
  • Promoter pBABE
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site SacII (not destroyed)
  • 5′ sequencing primer GGCATGGACGAGCTGTACAAG
  • 3′ sequencing primer GCATTCATTTTATGTTTCAGG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTK88_GFP-Anillin was a gift from Iain Cheeseman (Addgene plasmid # 46354 ; http://n2t.net/addgene:46354 ; RRID:Addgene_46354)