Skip to main content

pTK165_Mem-mCherry-4.1G-CTD
(Plasmid #46362)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46362 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 5183
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    4.1G C-terminal domain
  • Species
    H. sapiens (human)
  • Mutation
    C-terminal domain from 886-1005 amino acids
  • Entrez Gene
    EPB41L2 (a.k.a. 4.1-G, 4.1G)
  • Promoter CMV
  • Tags / Fusion Proteins
    • Mem (N-terminal 20 amino acids of neuromodulin for membrane targeting) (N terminal on backbone)
    • mCherry (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site SacII (not destroyed)
  • 5′ sequencing primer GGCATGGACGAGCTGTACAAG
  • 3′ sequencing primer GCATTCATTTTATGTTTCAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Neuromodulin N-terminal sequence is MLCCMRRTKQVEKNDDDQKI

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTK165_Mem-mCherry-4.1G-CTD was a gift from Iain Cheeseman (Addgene plasmid # 46362 ; http://n2t.net/addgene:46362 ; RRID:Addgene_46362)
  • For your References section:

    Cortical dynein and asymmetric membrane elongation coordinately position the spindle in anaphase. Kiyomitsu T, Cheeseman IM. Cell. 2013 Jul 18;154(2):391-402. doi: 10.1016/j.cell.2013.06.010. 10.1016/j.cell.2013.06.010 PubMed 23870127