-
Purposevisualizes chromosomes
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46363 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBABE
- Total vector size (bp) 6542
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameH2B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)400
-
MutationD26G, V119I and S125D
-
Entrez GeneH2BC11 (a.k.a. H2B/r, H2BFR, H2BJ, HIST1H2BJ)
- Promoter pBABE
-
Tag
/ Fusion Protein
- mCherry (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site SacII (not destroyed)
- 5′ sequencing primer GGCATGGACGAGCTGTACAAG
- 3′ sequencing primer GCATTCATTTTATGTTTCAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTK168_mCherry-H2B was a gift from Iain Cheeseman (Addgene plasmid # 46363 ; http://n2t.net/addgene:46363 ; RRID:Addgene_46363) -
For your References section:
Cortical dynein and asymmetric membrane elongation coordinately position the spindle in anaphase. Kiyomitsu T, Cheeseman IM. Cell. 2013 Jul 18;154(2):391-402. doi: 10.1016/j.cell.2013.06.010. 10.1016/j.cell.2013.06.010 PubMed 23870127