pENTR SD Age HsSAS-6
(Plasmid
#46381)
-
PurposeFor expression of C-terminal fusions.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46381 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepENTR1A
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2717
- Total vector size (bp) 4224
-
Modifications to backboneThe multiple cloning site of pENTR 1A was modified by introducing single restriction sites between the attR1 and attR2 sites (3-AgeI and XbaI-5), generating the entry vector pENTR-SD-Age-AGT
-
Vector typeEntry vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSAS-6
-
Alt nameSASS6
-
Alt namespindle assembly 6 homolog (C. elegans)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2000
-
Entrez GeneSASS6 (a.k.a. MCPH14, SAS-6, SAS6)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer pENTR-F
- 3′ sequencing primer pENTR-R (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Full length HsSAS-6 was amplified using the primers Age-Ko-HsSAS6-F (CGCGACCGGTACCATGAGCCAAGTGCTGTTCCAC) and Xba-noST-S6-R (CGCGTCTAGATAACTGTTTGGTAACTGCCCA), and cloned into pENTR-SD-Age vector by restriction digest with AgeI and XbaI.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR SD Age HsSAS-6 was a gift from Pierre Gonczy (Addgene plasmid # 46381 ; http://n2t.net/addgene:46381 ; RRID:Addgene_46381) -
For your References section:
Structural basis of the 9-fold symmetry of centrioles. Kitagawa D, Vakonakis I, Olieric N, Hilbert M, Keller D, Olieric V, Bortfeld M, Erat MC, Fluckiger I, Gonczy P, Steinmetz MO. Cell. 2011 Feb 4;144(3):364-75. doi: 10.1016/j.cell.2011.01.008. 10.1016/j.cell.2011.01.008 PubMed 21277013