-
PurposeOverproduction of LacI
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 46394 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBADmyc-hisB
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4092
- Total vector size (bp) 5080
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLacI
-
SpeciesEscherichia coli
-
Insert Size (bp)1110
-
Mutationsilent T to C mutation at position 19
- Promoter arabinose promoter
-
Tag
/ Fusion Protein
- 6xHIS tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (unknown if destroyed)
- 3′ cloning site SalI (unknown if destroyed)
- 5′ sequencing primer pBADseqF (5' AGCGGATCCTACCTGACG)
- 3′ sequencing primer pBADseqR (5' CTGAAAATCTTCTCTCATCCG)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
LacI expression was induced with 0.2% (w/v) L-arabinose and cells incubated for 4 h at 20 °C.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD-LacI was a gift from Florian Hollfelder (Addgene plasmid # 46394 ; http://n2t.net/addgene:46394 ; RRID:Addgene_46394) -
For your References section:
A single mutation in the core domain of the lac repressor reduces leakiness. Gatti-Lafranconi P, Dijkman WP, Devenish SR, Hollfelder F. Microb Cell Fact. 2013 Jul 8;12:67. doi: 10.1186/1475-2859-12-67. 10.1186/1475-2859-12-67 PubMed 23834731