FVIII H2
(Plasmid
#46773)
-
PurposepcDNA4.full length FVIII D1241E
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46773 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA4
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 12086
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namefull length FVIII D1241E
-
SpeciesH. sapiens (human)
-
Insert Size (bp)7053
-
MutationD1241E
-
Entrez GeneF8 (a.k.a. AHF, DXS1253E, F8B, F8C, FVIII, HEMA, THPH13)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site EcoRV (not destroyed)
- 5′ sequencing primer cccaagctggctagttaagcttcg
- 3′ sequencing primer ACCGGTATGCATATTCAGATCCTCTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Polymorphisms described in:
Inhibitors of factor VIII in black patients with hemophilia.
Viel KR, Ameri A, Abshire TC, Iyer RV, Watts RG, Lutcher C, Channell C, Cole SA, Fernstrom KM, Nakaya S, Kasper CK, Thompson AR, Almasy L, Howard TE.
N Engl J Med. 2009 Apr 16;360(16):1618-27. doi: 10.1056/NEJMoa075760. Erratum in: N Engl J Med. 2009 Jul 30;361(5):544.
PMID:1936966
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FVIII H2 was a gift from Robert Peters (Addgene plasmid # 46773 ; http://n2t.net/addgene:46773 ; RRID:Addgene_46773)