pMA3174
(Plasmid
#46880)
-
Purpose(Empty Backbone) Lentiviral vector for the dual control of expression through Tet-On promoter and C-terminal destabilizing domain
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46880 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMA3211
-
Backbone manufacturerHomemade
- Backbone size (bp) 6990
-
Vector typeLentiviral
- Promoter TRE-Tight
-
Selectable markersPuromycin
-
Tags
/ Fusion Proteins
- myc (C terminal on backbone)
- FFKBP12 E31G, R71G, K105E (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer ctatagtgaatagagttagg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMA3174 was a gift from Mikhail Alexeyev & Troy Stevens (Addgene plasmid # 46880 ; http://n2t.net/addgene:46880 ; RRID:Addgene_46880) -
For your References section:
Pseudomonas aeruginosa exotoxin Y is a promiscuous cyclase that increases endothelial tau phosphorylation and permeability. Ochoa CD, Alexeyev M, Pastukh V, Balczon R, Stevens T. J Biol Chem. 2012 Jul 20;287(30):25407-18. doi: 10.1074/jbc.M111.301440. Epub 2012 May 25. 10.1074/jbc.M111.301440 PubMed 22637478