pVC299 VEGF Site#2
(Plasmid #47506)

• Purpose: human gRNA expression vector targeting VEGF
• Depositing Lab: Keith Joung
• Publication: Fu et al Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	47506	Standard format: Plasmid sent in bacteria as agar stab	1	$65	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: MLM3636
  (Search Vector Database)
• Backbone manufacturer: Joung lab (Addgene plasmid #43860)
• Backbone size w/o insert (bp): 2278
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: gRNA-VEGF site 2
• Species: H. sapiens (human)
• Insert Size (bp): 20
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (not destroyed)
• 3′ cloning site: BsmBI (not destroyed)
• 5′ sequencing primer: hU6-F (5'-GAGGGCCTATTTCCCATGATT-3')

Resource Information

• Terms and Licenses:
  • UBMTA
• Article Citing this Plasmid:
  • 1 Reference

Depositor Comments

Target site: GACCCCCTCCACCCCGCCTC

gRNA expression vector targeting human VEGF for use with JDS246 (Addgene plasmid# 43861--mammalian codon-optimized streptococcus pyogenes Cas9)

For more information on Joung Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/jounglab/