pDR366 RNF2
(Plasmid
#47509)
-
Purposehuman gRNA expression vector targeting RNF2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 47509 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneMLM3636
-
Backbone manufacturerJoung lab (Addgene plasmid #43860)
- Backbone size w/o insert (bp) 2278
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA-RNF2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
-
Entrez GeneRNF2 (a.k.a. BAP-1, BAP1, DING, HIPI3, LUSYAM, RING1B, RING2)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (not destroyed)
- 3′ cloning site BsmBI (not destroyed)
- 5′ sequencing primer hU6-F (5'-GAGGGCCTATTTCCCATGATT-3') (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Target site: GTCATCTTAGTCATTACCTG
gRNA expression vector targeting human RNF2 for use with JDS246 (Addgene plasmid# 43861--mammalian codon-optimized streptococcus pyogenes Cas9)
For more information on Joung Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/jounglab/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDR366 RNF2 was a gift from Keith Joung (Addgene plasmid # 47509 ; http://n2t.net/addgene:47509 ; RRID:Addgene_47509) -
For your References section:
High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Fu Y, Foden JA, Khayter C, Maeder ML, Reyon D, Joung JK, Sander JD. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623. 10.1038/nbt.2623 PubMed 23792628