-
PurposeCFP tagged Parkin for colocalization study
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 47560 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepECFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4698
- Total vector size (bp) 6096
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameParkin
-
Alt namePark2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1398
-
GenBank IDNM_004562
-
Entrez GenePRKN (a.k.a. AR-JP, LPRS2, PARK2, PDJ)
- Promoter CMV
-
Tag
/ Fusion Protein
- CFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer AGAAGCGCGATCACATGG
- 3′ sequencing primer CAGCCATACCACATTTGTAG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CFP-Parkin was a gift from Richard Youle (Addgene plasmid # 47560 ; http://n2t.net/addgene:47560 ; RRID:Addgene_47560) -
For your References section:
Parkin is recruited selectively to impaired mitochondria and promotes their autophagy. Narendra D, Tanaka A, Suen DF, Youle RJ. J Cell Biol. 2008 Dec 1. 183(5):795-803. 10.1083/jcb.200809125 PubMed 19029340